MP02: pSicoR GFP

Vector Number: 

2.00
Files

Vector Map: 

Sequence Text: 

gcttaagcggtcgacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctga tgccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaa atttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgcttagggttaggcgttttg cgctgcttcgcgatgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaatc aattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccg cctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaa tagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagt gtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccag tacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtga tgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccc cattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactcc gccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagcgcgttttgcctgt actgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgctta agcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaacta gagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacttgaaag cgaaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcga ggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgag agcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaaga aaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcct gttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaa gaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggatagagataaaagaca ccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcggccgg ccgcgctgatcttcagacctggaggaggagatatgagggacaattggagaagtgaattatataaatataa agtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaa agagcagtgggaataggagctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgt caatgacgctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgag ggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatc ctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcattt gcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttggaatcacacgac ctggatggagtgggacagagaaattaacaattacacaagcttaatacactccttaattgaagaatcgcaa aaccagcaagaaaagaatgaacaagaattattggaattagataaatgggcaagtttgtggaattggttta acataacaaattggctgtggtatataaaattattcataatgatagtaggaggcttggtaggtttaagaat agtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcgtttcagacccac ctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagacagagaca gatccattcgattagtgaacggatcggcactgcgtgcgccaattctgcagacaaatggcagtattcatcc acaattttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatagtagacataatagcaac agacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttcgggtttattacagggac agcagagatccagtttggttagtaccgggcccgctctagagatccgacgccgccatctctaggcccgcgc cggccccctcgcacagacttgtgggagaagctcggctactcccctgccccggttaatttgcatataatat ttcctagtaactatagaggcttaatgtgcgataaaagacagataatctgttctttttaatactagctaca ttttacatgataggcttggatttctataacttcgtatagcatacattatacgaagttatacatgtcacaa aaggaaactcaccctaactgtaaagtaattgtgtgttttgagactataaatatcccttggagaaaagcct tgttaacgcgcggtgaccctcgagtactaggatccattaggcggccgcgtggataaccgtattaccgcca tgcattagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgtta cataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgac gtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaact gcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaat ggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtatt agtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactca cggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggact ttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtcta tataagcagagctggtttagtgaaccgtcagatccgctagcgctaccggtcgccaccatggtgagcaagg gcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagtt cagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccacc ggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgct accccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcac catcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtg aaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtaca actacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagat ccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgac ggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgaga agcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgta caagtaggaattcgtcgagggacctaataacttcgtatagcatacattatacgaagttatacatgtttaa gggttccggttccactaggtacaattcgatatcaagcttatcgataatcaacctctggattacaaaattt gtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcc tttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtct ctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaaccc ccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgc cacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaat tccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgc gcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgcc ggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctcc ccgcatcgataccgtcgacctcgatcgagacctagaaaaacatggagcaatcacaagtagcaatacagca gctaccaatgctgattgtgcctggctagaagcacaagaggaggaggaggtgggttttccagtcacacctc aggtacctttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaagggggg actggaagggctaattcactcccaacgaagacaagatatccttgatctgtggatctaccacacacaaggc tacttccctgattggcagaactacacaccagggccagggatcagatatccactgacctttggatggtgct acaagctagtaccagttgagcaagagaaggtagaagaagccaatgaaggagagaacacccgcttgttaca ccctgtgagcctgcatgggatggatgacccggagagagaagtattagagtggaggtttgacagccgccta gcatttcatcacatggcccgagagctgcatccggactgtactgggtctctctggttagaccagatctgag cctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttca agtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtgg aaaatctctagcagcatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctgg cgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaa cccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgacc ctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgct gtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcc cgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactg gcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggt ggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcgg aaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaag cagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctc agtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatcct tttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaa tgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccg tcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagaccc acgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcct gcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagtta atagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttc attcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagc tccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcac tgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtc attctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgcca catagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttac cgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcac cagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaa tgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcg gatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgcc acctgac